Navigation bar
  Print document Start Previous page
 5 of 9 
Next page End  

5
The PCR products are gel-purified using the GFX PCR purification kit (Amersham).
d. Polishing reaction to remove A-overhangs from ExTaq-generated fragments
PCR reaction mixture (no primers)
PCR cycle
25 µl DNA fragment
1x Pfu reaction buffer
0.2 mM 4 x dNTP
0.01 U/µl Pfu (Invitrogen)
total volume: 50 µl
1 cycle:
72°C
30 min
2. Triple template PCR (TT-PCR)
All three amplified fragments, i.e., TT-Citrine or TT-CFP, P1-P2, and P3-P4, are combined
together to serve as three overlapping templates for Long Flanking Homology (LFH) PCR (Wach
1996). This second PCR reaction, designated triple-template PCR (TT-PCR), utilizes two primers
containing the complete attB1 and attB2 Gateway sequences (Walhout et al. 2000) and partially
overlapping the P1 and P4 primers (Figure 4). Thus, TT-PCR introduces the fluorescent tag into the
selected site within the target gene without the need for conventional cloning and results in an
internally-tagged full-length gene sequence flanked by attB1 and attB2 sites ready for Gateway
recombination cloning.
a. Three templates
P1-P2 fragment, TT-Citrine or TT-CFP fragment, and P3-P4 fragment.
b. Primers
Universal, gene-non-specific primers carrying the Gateway attB1 and attB2 sequences that
overlap with the gene-non-specific sequences of P1 and P4 primers (Figure 6).
forward attB1
Gateway primer:
  5'-GGGG
ACAAGTTTGTACAAAAAAGCAGGCT
GCTCGATCCACCTAGGCT
-3'
  
reverse attB2
Gateway primer:   5'-GGGG
ACCACTTTGTACAAGAAAGCTGGGT
CGTAGCGAGACCACAGGA
-3'
Figure 6
. Nucleotide sequences of forward attB1 and reverse attB2 Gateway primers. Blue boxes
indicate attB1 and attB2 sequences. Sequences of forward and reverse primers overlapping P1 and P
primers, respectively, are indicated in dark red.
attB1
attB2
c. TT-PCR conditions
TT-PCR reaction mixture
TT-PCR cycles
100 ng P1-P2 fragment+50ng P3-P4
fragment+50ng TT-Citrine or TT-CFP
1x ExTaq reaction buffer
0.2 mM 4 x dNTP
0.2 µM of each primer
0.02 U/µl ExTaq (TaKaRa)
total volume: 20 µl
1 cycle:
94°C
2 min 30 sec
20 cycles:
94°C
30 sec
62-65°C
30 sec*
68°C
1 min per kb
1 cycle:
68°C
10 min
* lowering temperature of this step to 54°C may improve the recombination of the resulting TT-PCR
product into pDONR207 by 2-3 fold.
The PCR products are gel-purified using the GFX PCR purification kit (Amersham).
  Print document Start Previous page
 5 of 9 
Next page End